TP4433, TP4433 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP4433
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP4433TP4433Fragaria iinumaemarker_locus
TP4433TP4433-31.606Fragaria iinumaemarker_locus


Sequence
>TP4433 ID=TP4433|Name=TP4433|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCGAGGGCAGCAGCAGCCTCAGCTGCGGCCTCACTGCCTGGAGAAC
TCGAAGTGATCTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A31.61TP4433View
2Fragaria-Fii5N/A31.61TP4433-31.606View