7_496478, 7_496478 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_496478
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_4964787_496478Fragaria iinumaemarker_locus
7_4964787_496478-33.543Fragaria iinumaemarker_locus


Sequence
>7_496478 ID=7_496478|Name=7_496478|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CACCCCACTTTCAGACAAAGACTCCCTCTTTCCCTTTCCCCCAATATCTC
TCCTTTGACCCGCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A33.547_496478View
2Fragaria-Fii5N/A33.547_496478-33.543View