7_496421, 7_496421 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_496421
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_4964217_496421Fragaria iinumaemarker_locus
7_4964217_496421-33.543Fragaria iinumaemarker_locus


Sequence
>7_496421 ID=7_496421|Name=7_496421|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CATTTCTAGTCAACCGGCCATGCCGTCCACTATAGTCCAATATCAATCTT
CCATTCCCACCCCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A33.547_496421View
2Fragaria-Fii5N/A33.547_496421-33.543View