TP7830, TP7830 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP7830
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP7830TP7830Fragaria iinumaemarker_locus
TP7830TP7830-35.977Fragaria iinumaemarker_locus


Sequence
>TP7830 ID=TP7830|Name=TP7830|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTACAAGGACACAACTGAAGCTGCTATTTCTGGGGTGAGAAGCATT
GCTGATTCTTGCAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A35.98TP7830View
2Fragaria-Fii5N/A35.98TP7830-35.977View