7_95031, 7_95031 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_95031
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_950317_95031Fragaria iinumaemarker_locus
7_950317_95031-35.977Fragaria iinumaemarker_locus


Sequence
>7_95031 ID=7_95031|Name=7_95031|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTTGCCTCTGCAGCTTCACATACTCAATACCTTTCTTCTGTTCTCTGCCC
AACTCAGTTCCTTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A35.987_95031View
2Fragaria-Fii5N/A35.987_95031-35.977View