7_60037, 7_60037 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_60037
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_600377_60037Fragaria iinumaemarker_locus
7_600377_60037-35.977Fragaria iinumaemarker_locus


Sequence
>7_60037 ID=7_60037|Name=7_60037|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGTTGTGACCAGAGGGGGGTAGATATTAGGAACCCCCAGCAATACACTGC
AGCTATAAATAGGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A35.987_60037View
2Fragaria-Fii5N/A35.987_60037-35.977View