7_59972, 7_59972 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_59972
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_599727_59972Fragaria iinumaemarker_locus
7_599727_59972-35.977Fragaria iinumaemarker_locus


Sequence
>7_59972 ID=7_59972|Name=7_59972|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GGGCAACATAGTCATATCATTCACCATGCAACTTTGACCAAATTTCAAAT
CTCTAACAATTTTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A35.987_59972View
2Fragaria-Fii5N/A35.987_59972-35.977View