3_42026, 3_42026 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_42026
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_420263_42026Fragaria iinumaemarker_locus
3_420263_42026-37.441Fragaria iinumaemarker_locus


Sequence
>3_42026 ID=3_42026|Name=3_42026|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AAGTTGTTCAATACTATCACTTCCTATCAGCCTCAATGCAAACCAGATCA
ACCACAGTCCCACT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A37.443_42026View
2Fragaria-Fii5N/A37.443_42026-37.441View