3_101994, 3_101994 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_101994
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_1019943_101994Fragaria iinumaemarker_locus
3_1019943_101994-37.441Fragaria iinumaemarker_locus


Sequence
>3_101994 ID=3_101994|Name=3_101994|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ACCAAATCATTACACAAGCACATAAATCGAAYGGTAACACAAGATTCTGA
TGTAATGAAACAGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A37.443_101994View
2Fragaria-Fii5N/A37.443_101994-37.441View