3_102053, 3_102053 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_102053
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_1020533_102053Fragaria iinumaemarker_locus
3_1020533_102053-37.441Fragaria iinumaemarker_locus


Sequence
>3_102053 ID=3_102053|Name=3_102053|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ACAGTAGAAGACTACAAAGACCAGCACAGTATAGATTCTAACCTTGACCG
GCAGTTTTGGGGGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A37.443_102053View
2Fragaria-Fii5N/A37.443_102053-37.441View