TP3052, TP3052 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3052
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3052TP3052Fragaria iinumaemarker_locus
TP3052TP3052-39.387Fragaria iinumaemarker_locus


Sequence
>TP3052 ID=TP3052|Name=TP3052|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCACAGTCTTCTGTTCCTCGGCTTGGGTTGGAGAGAGAAGGTGAGG
AGGCTTTTAGTAGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A39.39TP3052View
2Fragaria-Fii5N/A39.39TP3052-39.387View