3_707208, 3_707208 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_707208
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_7072083_707208Fragaria iinumaemarker_locus
3_7072083_707208-42.63Fragaria iinumaemarker_locus


Sequence
>3_707208 ID=3_707208|Name=3_707208|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GGTCTGCCCTTCAACACCTCCCTCACAGCCTTGGTATCAGGACAAACCCC
CTTAGCCATAATGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A42.633_707208View
2Fragaria-Fii5N/A42.633_707208-42.63View