3_713730, 3_713730 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_713730
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_7137303_713730Fragaria iinumaemarker_locus
3_7137303_713730-43.264Fragaria iinumaemarker_locus


Sequence
>3_713730 ID=3_713730|Name=3_713730|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTGGTTCCACCCCAGAAACCGACATGTGCTTRAACACTCTGAGAGCATCC
TTGGTCCTGTCCCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A43.263_713730View
2Fragaria-Fii5N/A43.263_713730-43.264View