3_740314, 3_740314 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_740314
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_7403143_740314Fragaria iinumaemarker_locus
3_7403143_740314-43.264Fragaria iinumaemarker_locus


Sequence
>3_740314 ID=3_740314|Name=3_740314|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AAAATAGCACATAACCAACTCACCACGCCGAACCAAAGATCATGAAGTTT
CCTCCGGTAACTAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A43.263_740314View
2Fragaria-Fii5N/A43.263_740314-43.264View