TP9544, TP9544 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP9544
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP9544TP9544Fragaria iinumaemarker_locus
TP9544TP9544-44.713Fragaria iinumaemarker_locus


Sequence
>TP9544 ID=TP9544|Name=TP9544|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTTGGAGGGTGAAAATTTTAAACCTGAAGCGGAGTATCTCTCCGAG
ATCGGAAGAGCGGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A44.71TP9544View
2Fragaria-Fii5N/A44.71TP9544-44.713View