3_1024375, 3_1024375 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_1024375
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_10243753_1024375Fragaria iinumaemarker_locus
3_10243753_1024375-45.196Fragaria iinumaemarker_locus


Sequence
>3_1024375 ID=3_1024375|Name=3_1024375|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CAACACCTCCTCATCCAGAACCTAAGCCAAAGAGACAGAAGCTTGATAAT
TCCATGCTTATTCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A45.23_1024375View
2Fragaria-Fii5N/A45.23_1024375-45.196View