TP2744, TP2744 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2744
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2744TP2744Fragaria iinumaemarker_locus
TP2744TP2744-46.163Fragaria iinumaemarker_locus


Sequence
>TP2744 ID=TP2744|Name=TP2744|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCAAATATTCCTAAGAATCTTGAAGCAAGAAGAAGATTAGAATTTT
TCACAAATTCGTTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A46.16TP2744View
2Fragaria-Fii5N/A46.16TP2744-46.163View