|
Marker Overview
Name | WBGCAS20 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Primer 1 | WBGCAS20.forward primer: AAGAGAGGCCAAGACGAAATCG |
Primer 2 | WBGCAS20.reverse primer: ACGTTCTTGCACAAGAGCTTTC |
Publication | [view all] |
Contact | Yuepeng Han
|
Publications
Year | Publication |
2012 | Zhang Q, Ma B, Li H, Chang Y, Han Y, Li J, Wei G, Zhao S, Khan MA, Zhou Y, Gu C, Zhang X, Han Z, Korban SS, Li S, Han Y. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple. BMC genomics. 2012; 13:537. |
|