FB_AFFY_1361189, FB_AFFY_1361189 (genetic_marker) Malus x domestica

Marker Overview
NameFB_AFFY_1361189
dbSNP IDN/A
SNP Array ID
480K SNP array for apple:AX-105185562
50K SNP array for apple:AX-105185562
TypeSNP
SNP AllelesY
5' Flanking SequenceCGTTATGCTCAGCGCGTGCATGGCTTAAAGCGTGT
3' Flanking SequenceTTTATCATCGATTTTGATGTCCATCATGGGAATGG
SpeciesMalus x domestica
Publication[view all]
Libraries
Library NameType
480K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr01chromosomeChr01:2118186..2118186 +Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotationn/a
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-BB-F11N/A3.24FB_AFFY_1361189View
2Apple-NC-F11N/A0.11FB_AFFY_1361189View
3Apple-NCZFBB-consensus1N/A0FB_AFFY_1361189View
4Apple-ZF-F11N/A0.57FB_AFFY_1361189View
Sequence
>FB_AFFY_1361189 ID=FB_AFFY_1361189; Name=FB_AFFY_1361189; organism=Malus x domestica; type=genetic_marker; length=66bp
CAGCGCGTGCATGGCTTAAAGCGTGT[C/T]TTTATCATCGATTTTGATG
TCCATCATGGGAATGG