NB105a, NB105a (genetic_marker) Pyrus sp.

Marker Overview
NameNB105a
Genbank IDN/A
TypeSSR
SpeciesPyrus communis
Repeat Motif(AG)15AT(AG)10
Primer 1NB105a.forward primer: aaacaaccgactgagcaacatc
Primer 2NB105a.reverse primer: aaaatcttagcccaaaatctcc
Publication[view all]
ContactMiyuki Kunihisa
Toshiya Yamamoto
Contact
NameDetails
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Toshiya Yamamoto
First name:Toshiya
Last name:Yamamoto
Institution:National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:Japan
Email:toshiya@affrc.go.jp
Last update:Apr 2014
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNB105a.forward primerPyrus communisprimer
reverse primerNB105a.reverse primerPyrus communisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NB105aNB105a-1.25Pyrus communismarker_locus
NB105aNB105a-65.8Pyrus communismarker_locus
NB105aNB105a-63.3Pyrus communismarker_locus
NB105aNB105aPyrus communismarker_locus
NB105aNB105a-67.7Pyrus communismarker_locus
NB105aNB105a-185.1Pyrus communismarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-M-F1-maleLG11N/A1.25NB105aView
2Pear-RM-F1-IntegratedLG11N/A1.25NB105aView
3Apple-JM7xS63-F1J11N/A65.8NB105aView
4Apple-JM7xS63-F1S11N/A63.3NB105aView
5Apple-OA-F1-AkaneAK11N/A77.2NB105aView
6Pear-Rcf-F1-femaleLG11N/A0NB105aView
7Pear-Bartlett-F1-2007Ba11N/A68.7NB105aView
8Pear-La_France-F1-2007La11N/A69.2NB105aView
9Pear-Ba-F1-2013Ba11N/A67.7NB105aView
10Pear-integrated_consensus_map-IPCG-2017LG11N/A185.1NB105aView