|
Marker Overview
Name | NB111a |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus communis |
Repeat Motif | (AG)19 |
Primer 1 | NB111a.forward primer: ccaagctgtgattataggaag |
Primer 2 | NB111a.reverse primer: aggctgaaagattgtaaggt |
Max Length | 162 bp |
Publication | [view all] |
Contact | Toshiya Yamamoto
|
Publications
Year | Publication |
2002 | Yamamoto T, Kimura T, Shoda M, Imai T, Saito T, Sawamura Y, Kotobuki K, Hayashi T, Matsuta N. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Dec; 106(1):9-18. |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
|