NH007b, NH007b (genetic_marker) Pyrus pyrifolia

Marker Overview
NameNH007b
Genbank IDN/A
TypeSSR
SpeciesPyrus pyrifolia
Repeat Motif(AG)25
PCR Condition55
Primer 1NH007b.forward primer: TACCTTGATGGGAACTGAAC
Primer 2NH007b.reverse primer: AATAGTAGATTGCAATTACTC
Product Length150
Publication[view all]
ContactToshiya Yamamoto
Miyuki Kunihisa
Contact
NameDetails
Toshiya Yamamoto
First name:Toshiya
Last name:Yamamoto
Institution:National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:Japan
Email:toshiya@affrc.go.jp
Last update:Apr 2014
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNH007b.forward primerPyrus pyrifoliaprimer
reverse primerNH007b.reverse primerPyrus pyrifoliaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NH007bNH007b-125.798Pyrus pyrifoliamarker_locus
NH007bNH007b-118.901Pyrus pyrifoliamarker_locus
NH007bNH007b-29.6Pyrus pyrifoliamarker_locus
NH007bNH007bPyrus pyrifoliamarker_locus
NH007NH007Pyrus pyrifoliamarker_locus
NH007bNH007b-10.2Pyrus pyrifoliamarker_locus
NH007bNH007b-14.9Pyrus pyrifoliamarker_locus
NH007bNH007b-14.452Pyrus pyrifoliamarker_locus
NH007bNH007b-14.251Pyrus pyrifoliamarker_locus
NH007bNH007b-41.33Pyrus pyrifoliamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pear-M-F1-maleLG16N/A125.8NH007bView
2Pear-RM-F1-IntegratedLG16N/A118.9NH007bView
3Apple-FjMp-F1LG16N/A29.6NH007bView
4Apple-MM-F116N/A14.9NH007bView
5Apple-M432-2012LG16N/A16.8NH007bView
6Pear-Bartlett-F1-2007Ba16N/A8.5NH007bView
7Pear-La_France-F1-2007La16N/A6.8NH007bView
8Pear-BH-F1Ba16N/A5.2NH007View
9Pear-Ba-F1-2013Ba16N/A10.2NH007bView
10Pear-BD-F1-2015LG16N/A14.9NH007bView
11Pear-Bayuehong-F1-2015LG16N/A14.45NH007bView
12Pear-Dangshansuli-F1-2015LG16N/A14.25NH007bView
13Pear-integrated_consensus_map-IPCG-2017LG16N/A41.33NH007bView