|
Marker Overview
Name | NH007b |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus pyrifolia |
Repeat Motif | (AG)25 |
PCR Condition | 55 |
Primer 1 | NH007b.forward primer: TACCTTGATGGGAACTGAAC |
Primer 2 | NH007b.reverse primer: AATAGTAGATTGCAATTACTC |
Product Length | 150 |
Publication | [view all] |
Contact | Toshiya Yamamoto Miyuki Kunihisa
|
Publications
Year | Publication |
2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002; 2(1):14-16. |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16. |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
|