NH029a, NH029a (genetic_marker) Pyrus sp.

Marker Overview
NameNH029a
Genbank IDN/A
TypeSSR
SpeciesPyrus pyrifolia
Repeat Motif(AG)8
Primer 1NH029a.forward primer: gaagaaaaccagagcagggca
Primer 2NH029a.reverse primer: cctcccgtctcccaccatattag
Max Length101 bp
Publication[view all]
ContactToshiya Yamamoto
Miyuki Kunihisa
Publications
YearPublication
2002Tao R, Habu T, Namba A, Yamane H, Fuyuhiro F, Iwamoto K, Sugiura A. Inheritance of S(f)-RNase in Japanese apricot ( Prunus mume) and its relation to self-compatibility. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Aug; 105(2-3):222-228.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2004Plant Breeding, 123(4):321
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002Yamamoto T, Kimura T, Shoda M, Imai T, Saito T, Sawamura Y, Kotobuki K, Hayashi T, Matsuta N. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2002 Dec; 106(1):9-18.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2004Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2015Luigi Falginella, Guido Cipriani, Corinne Monte, Roberto Gregori, Raffaele Testolin, Riccardo Velasco, Michela Troggio, Stefano Tartarini. A major QTL controlling apple skin russeting maps on the linkage group 12 of ‘Renetta Grigia di Torriana’. BMC Plant Biology. 2015; 15:150.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
Contact
NameDetails
Toshiya Yamamoto
First name:Toshiya
Last name:Yamamoto
Institution:National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:Japan
Email:toshiya@affrc.go.jp
Last update:Apr 2014
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNH029a.forward primerPyrus pyrifoliaprimer
reverse primerNH029a.reverse primerPyrus pyrifoliaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NH029aNH029a-20.5Pyrus pyrifoliamarker_locus
NH029aNH029a-27.4Pyrus pyrifoliamarker_locus
NH029aNH029aPyrus pyrifoliamarker_locus
NH029aNH029a-12.9Pyrus pyrifoliamarker_locus
NH029aNH029a-59.4Pyrus pyrifoliamarker_locus
NH029aNH029a-53.27Pyrus pyrifoliamarker_locus
NH029aNH029a-59.156Pyrus pyrifoliamarker_locus
NH029aNH029a-66.31Pyrus pyrifoliamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1J9N/A20.5NH029aView
2Apple-JM7xS63-F1S9N/A27.4NH029aView
3Pear-PM-F1-Moonglow9N/A15.16NH029aView
4Apple Integrated map9N/A18.3NH029aView
5Apple-C16xC17-F1-20129N/A32.88NH029aView
6Apple-X3259X3263-F19N/A16.18NH029aView
7Apple-RGTxGD-F1-2015RGT_9N/A7.83NH029aView
8Apple-RGTxGD-F1-2015GD_9N/A21.13NH029aView
9Apple-JG-F1LG9N/A39.6NH029aView
10Apple-JGxWSH-F1LG9N/A24.8NH029aView
11Apple-WSH-F1LG9N/A18.4NH029aView
12Pear-Bartlett-F1-2007Ba9N/A6.7NH029aView
13Pear-La_France-F1-2007La9N/A7.9NH029aView
14Pear-Ba-F1-2013Ba9N/A12.9NH029aView
15Pear-BD-F1-2015LG9N/A59.4NH029aView
16Pear-Bayuehong-F1-2015LG9N/A53.27NH029aView
17Pear-Dangshansuli-F1-2015LG9N/A59.16NH029aView
18Pear-integrated_consensus_map-IPCG-2017LG9N/A66.31NH029aView