UDAp-439, UDAp-439 (genetic_marker) Prunus armeniaca

Marker Overview
NameUDAp-439
Genbank IDBV211244
TypeSSR
SpeciesPrunus armeniaca
GermplasmPortici
Source Typegenomic DNA
PCR Condition95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min
Primer 1UDAp-439.F primer: TTCGCACTATCCATGGAACC
Primer 2UDAp-439.R primer: CCCAAATGTGTTTTTGATTGG
Product Length118bp
Publication[view all]
ContactR. Testolin
Contact
NameDetails
R. Testolin
First name:Raffaele
Last name:Testolin
Institution:University of Udine, Italy
Address:Dipartimento di Scienze Agrarie e Ambientali University of Udine Via delle Scienze 208 I-33100 Udine, Italy
Country:Italy
Email:raffaele.testolin@uniud.it
Phone:0432 558632
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerUDAp-439.R primerPrunus armeniacaprimer
F primerUDAp-439.F primerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDAp-439UDAp-439Prunus armeniacamarker_locus
UDAp439UDAp439Prunus armeniacamarker_locus


Germplasm
Stock NameType
Porticicultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG4N/A34.1UDAp-439View
2Apricot-LB-F1B4N/A54.98UDAp-439View
3Apricot-LB-F1L4N/A34.3UDAp-439View
4Peach_CxEL_F1CxEL4N/A49.4UDAp-439View
5Apricot-BC-F1-2016B4N/A43UDAp-439View
6Apricot-BC-F1-2016C4N/A36.5UDAp-439View
7Apricot-GC-F1-2016G4N/A70.3UDAp-439View
8Apricot-GC-F1-2016C4N/A64.7UDAp-439View
9Prunus-TxE-peachV2.0LG4N/A34.7UDAp-439View
10Apricot-BC-F1-2016-PhenologyC4N/A48UDAp439View
11Apricot-GC-F1-2016-PhenologyC4N/A47.3UDAp439View
12Apricot-GC-F1-2016-PhenologyG4N/A61.6UDAp439View