UDAp-466, UDAp-466 (genetic_marker) Prunus armeniaca

Marker Overview
NameUDAp-466
Genbank IDBV211265
TypeSSR
SpeciesPrunus armeniaca
GermplasmPortici
Source Typegenomic DNA
PCR Condition95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min
Primer 1UDAp-466.F primer: AATTGTGTGTGTGTGTAACTGAG
Primer 2UDAp-466.R primer: TTGTTGAGAATGGGGGTACT
Product Length160bp
Publication[view all]
ContactR. Testolin
Maria Badenes
Contact
NameDetails
R. Testolin
First name:Raffaele
Last name:Testolin
Institution:University of Udine, Italy
Address:Dipartimento di Scienze Agrarie e Ambientali University of Udine Via delle Scienze 208 I-33100 Udine, Italy
Country:Italy
Email:raffaele.testolin@uniud.it
Phone:0432 558632
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerUDAp-466.R primerPrunus armeniacaprimer
F primerUDAp-466.F primerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
UDAp-466UDAp-466Prunus armeniacamarker_locus


Germplasm
Stock NameType
Porticicultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG1N/A0UDAp-466View
2Apricot-integrated-Goldrich-2011LG1N/A13.4UDAp-466View
3Prunus-TxE-peachV2.0LG1N/A0UDAp-466View