|
|
Marker Overview
| Name | UDAp-471 |
|---|
| Genbank ID | BV211269 |
|---|
| Type | SSR |
|---|
| Species | Prunus armeniaca |
|---|
| Germplasm | Portici |
|---|
| Source Type | genomic DNA |
|---|
| PCR Condition | 95 C 2 min, 94 C 20 sec, 56 C 20 sec, 65 C 40 sec. 25 cycles, 65 C 7 min |
|---|
| Primer 1 | UDAp-471.F primer: CGATGAACAGACACCGTTGA |
|---|
| Primer 2 | UDAp-471.R primer: AGTCCGTCTTTGCTCAGCTC |
|---|
| Product Length | 157bp |
|---|
| Publication | [view all] |
|---|
| Contact | R. Testolin
Amy Iezzoni
|
|---|
Publications
| Year | Publication |
|---|
| 2004 | Messina R, Lain O, Marrazzo M, Cipriani G, Testolin R. New set of microsatellite loci isolated in apricot. Molecular ecology notes. 2004; 4(3):432-434. |
| 2004 | Messina R, Lain O, Marrazzo MT, Huang WG, Cipriani G, Testolin R. Isolation of microsatellites from almond and apricot genomic libraries and testing for their transportability across different Prunus species. Acta Horticulturae. 2004; 663:79-82. |
| 2007 | Dondini L, Lain O, Geuna F, Banfi R, Gaiotti F, Tartarini S, Bassi D, Testolin R. Development of a new SSR-based linkage map in apricot and analysis of synteny with existing Prunus maps. Tree Genetics and Genomes. 2007; 3(3):239–249. |
| 2008 | Olmstead JW, Sebolt AM, Cabrera A, Sooriyapathirana SS, Hammar S, Iriarte G, Wang D, Chen CY, van der Knaap E, Iezzoni AF. Construction of an intra-specific sweet cherry (Prunus avium L.) genetic linkage map and synteny analysis with the Prunus reference map. Tree Genetics and Genomes. 2008; 4(4):897-910. |
|
