s1_29994284, s1_29994284 (genetic_marker) Prunus avium

Marker Overview
Names1_29994284
dbSNP IDN/A
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTTCCTTGACATCTCTCTGTTATTTCTTTCGCCTCCCACTTTCTGCTTCCCCTCACTTTTC CGACCTTTTGCCACCTTACCACTTTCTAACAACCGCTGTTTCTGCACACTAGCATCCTTC TCTTTTTCTTTCATCCTGCTGCCTTCACTT
3' Flanking SequenceTTGTTTTCGTATCTTGGGATAAGTTGGTTTCTCCTGAGGCATCATGTGATTCAGTTGTGC TTACAGGAGCACTAGCAGTGGGATCTTCATCCTTTCCTACCTCTGAATATGAGGCCAATC CTGCAGCAGCTCCACTCCCTGGACTTGTTG
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intergenic SNPs
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s1_29994284s1_29994284Prunus aviummarker_locus


Sequence
>s1_29994284 ID=s1_29994284|Name=s1_29994284|organism=Prunus avium|type=genetic_marker|length=301bp
TTCCTTGACATCTCTCTGTTATTTCTTTCGCCTCCCACTTTCTGCTTCCC
CTCACTTTTCCGACCTTTTGCCACCTTACCACTTTCTAACAACCGCTGTT
TCTGCACACTAGCATCCTTCTCTTTTTCTTTCATCCTGCTGCCTTCACTT
YTTGTTTTCGTATCTTGGGATAAGTTGGTTTCTCCTGAGGCATCATGTGA
TTCAGTTGTGCTTACAGGAGCACTAGCAGTGGGATCTTCATCCTTTCCTA
CCTCTGAATATGAGGCCAATCCTGCAGCAGCTCCACTCCCTGGACTTGTT
G
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 1N/A29994284s1_29994284View
Alignments
Feature NameTypeLocationAnalysis
Pp01 chromosome Pp01:30968215..30968215. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)