s2_20486026, s2_20486026 (genetic_marker) Prunus avium

Marker Overview
Names2_20486026
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s2_20486026
TypeSNP
SNP AllelesT/C
5' Flanking SequenceGCTTTGCCCCATGAATTGGTTGGTTCTGCACCTTGATCGGTTCCTTGTTTTGCCTCACCT GATTGATTCCAACCACAGGACTGAGCCCCACTTGAAGTGCTTGATTGCTTCCAGTCGGAT GATTTACCTCCTCCAGCAGCACTTGGTTGG
3' Flanking SequenceCTCCAGTACCGCCTCCAAATCCTGAACCTGTTCCTTTGTTCCAACCTGAACCCTGGTTGC CCAAGCCCCCAGCTTGTGCGCTTGAGCTTGGTCCCTTGTTCTGGCCACCATCTTGATCAG TGGTTCCTTTGATTTCTTTGGCTGCAGTCG
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intergenic SNPs
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s2_20486026s2_20486026Prunus aviummarker_locus


Sequence
>s2_20486026 ID=s2_20486026|Name=s2_20486026|organism=Prunus avium|type=genetic_marker|length=301bp
GCTTTGCCCCATGAATTGGTTGGTTCTGCACCTTGATCGGTTCCTTGTTT
TGCCTCACCTGATTGATTCCAACCACAGGACTGAGCCCCACTTGAAGTGC
TTGATTGCTTCCAGTCGGATGATTTACCTCCTCCAGCAGCACTTGGTTGG
YCTCCAGTACCGCCTCCAAATCCTGAACCTGTTCCTTTGTTCCAACCTGA
ACCCTGGTTGCCCAAGCCCCCAGCTTGTGCGCTTGAGCTTGGTCCCTTGT
TCTGGCCACCATCTTGATCAGTGGTTCCTTTGATTTCTTTGGCTGCAGTC
G
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 2N/A20486026s2_20486026View
Alignments
Feature NameTypeLocationAnalysis
Pp02 chromosome Pp02:24061584..24061584. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr2 chromosome PAV_r1.0chr2:18193983..18193983. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)