|
Marker Overview
Name | s2_24581004 |
dbSNP ID | N/A |
SNP Array ID | Cherry 6+9K SNP array: | s2_24581004 |
|
Type | SNP |
SNP Alleles | T/C |
5' Flanking Sequence | AGAGACTTCAGCGGTGCTGTTTTCAAAAACAATGGTGTAAAACTTGCTCGGATAATTTC |
3' Flanking Sequence | GCAG |
Species | Prunus avium |
Publication | [view all] |
Contact | Patricio Hinrichsen Stijn Vanderzande
|
Comment | sweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intergenic SNPs |
Publications
Year | Publication |
2015 | Guajardo V, Solís S, Sagredo B, Gainza F, Muñoz C, Gasic K, Hinrichsen P. Construction of high density sweet cherry (Prunus avium L.) linkage maps using microsatellite markers and SNPs detected by genotyping-by-sequencing (GBS). PLoS ONE 2015. |
2020 | Vanderzande S, Zheng P, Cai L, Barac G, Gasic K, Main D, Iezzoni A and Peace C. The cherry 6+9K SNP array: a cost-effective improvement to the cherry 6K SNP array for genetic studies. Scientific Reports 10, 7613 (2020). https://doi.org/10.1038/s41598-020-64438-x |
Sequence
>s2_24581004 ID=s2_24581004; Name=s2_24581004; organism=Prunus avium; type=genetic_marker; length=64bp AGAGACTTCAGCGGTGCTGTTTTCAAAAACAATGGTGTAAAACTTGCTCG GATAATTTCYGCAG
Alignments
Feature Name | Type | Location | Analysis |
Pp02 |
chromosome |
Pp02:28178343..28178343. |
Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1) |
|