s8_375147, s8_375147 (genetic_marker) Prunus avium

Marker Overview
Names8_375147
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s8_375147
TypeSNP
SNP AllelesT/C
5' Flanking SequenceAATGTCCGAATG
3' Flanking SequenceACAAAAGGGAAGAGCTTTGCTCTAAATGAAGTTGAGGTATCATATCTGCAG
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intragenic SNPs
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s8_375147s8_375147Prunus aviummarker_locus


Sequence
>s8_375147 ID=s8_375147|Name=s8_375147|organism=Prunus avium|type=genetic_marker|length=64bp
AATGTCCGAATGYACAAAAGGGAAGAGCTTTGCTCTAAATGAAGTTGAGG
TATCATATCTGCAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 8N/A375147s8_375147View
2Sweet Cherry-RosBREED-3.8K-20208N/A2.6s8_375147View
3Sweet Cherry-VxC-F1-6+9K_array8N/A3.24s8_375147View
Alignments
Feature NameTypeLocationAnalysis
Pp08 chromosome Pp08:375066..375066. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr8 chromosome PAV_r1.0chr8:406306..406306. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)