NZ04f3, NZ04f3 (genetic_marker) Malus x domestica

Marker Overview
NameNZ04f3
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(ga)14
Primer 1NZ04f3.forward primer: caaaaccaccctcatcctcgaa
Primer 2NZ04f3.reverse primer: ccc caa gca gac ctg aag aaa
Product Length111
Publication[view all]
ContactP. Guilford
Contact
NameDetails
P. Guilford
First name:P.
Last name:Guilford
Institution:Horticulture and Food Research Institute of New Zealand
Address:Horticulture and Food Research Institute of New Zealand, Mt Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Country:New Zealand
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNZ04f3.forward primerMalus x domesticaprimer
reverse primerNZ04f3.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZ04f3NZ04f3Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JGD-F1-2014J9N/A13.2NZ04f3View