|
Marker Overview
Name | NZ04f3 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (ga)14 |
Primer 1 | NZ04f3.forward primer: caaaaccaccctcatcctcgaa |
Primer 2 | NZ04f3.reverse primer: ccc caa gca gac ctg aag aaa |
Product Length | 111 |
Publication | [view all] |
Contact | P. Guilford
|
Publications
Year | Publication |
2014 | Yuansheng Chang, Rui Sun, Huanhuan Sun, Yongbo Zhao, Yuepeng Han,
Dongmei Chen, Yi Wang, Xinzhong Zhang, Zhenhai Han. Mapping of quantitative trait loci corroborates independent genetic control of apple size and shape. Scientia Horticulturae. 2014; 174:126–132. |
1997 | Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254. |
|