NZmsEB146613, NZmsEB146613 (genetic_marker) Malus x domestica

Marker Overview
NameNZmsEB146613
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(TTCC)8
Primer 1NZmsEB146613.forward primer: AGAGTTCCGTTCCCCTCTCT
Primer 2NZmsEB146613.reverse primer: GTGGATTCGGAAATGCACTC
Publication[view all]
ContactS. Gardiner
Contact
NameDetails
S. Gardiner
First name:Sue
Last name:Gardiner
Institution:HortResearch, New Zealand
Address:HortResearch Palmerston North Tennent Drive Private Bag 11 030 Palmerston North, New Zealand
Email:sgardiner@hortresearch.co.nz
Phone:64-6-356 8080
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit sizeqFRSZ.JGD-G14.2009Malus x domesticaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNZmsEB146613.forward primerMalus x domesticaprimer
reverse primerNZmsEB146613.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZmsEB146613NZmsEB146613Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JGD-F1-2014G14N/A103.8NZmsEB146613View