|
Marker Overview
Name | NZmsEB146613 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (TTCC)8 |
Primer 1 | NZmsEB146613.forward primer: AGAGTTCCGTTCCCCTCTCT |
Primer 2 | NZmsEB146613.reverse primer: GTGGATTCGGAAATGCACTC |
Publication | [view all] |
Contact | S. Gardiner
|
Publications
Year | Publication |
2014 | Yuansheng Chang, Rui Sun, Huanhuan Sun, Yongbo Zhao, Yuepeng Han,
Dongmei Chen, Yi Wang, Xinzhong Zhang, Zhenhai Han. Mapping of quantitative trait loci corroborates independent genetic control of apple size and shape. Scientia Horticulturae. 2014; 174:126–132. |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
|