WBGCAS24, WBGCAS24 (genetic_marker) Malus x domestica

Marker Overview
NameWBGCAS24
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Primer 1WBGCAS24.forward primer: TGACATGTGGCGCTACATATGG
Primer 2WBGCAS24.reverse primer: ATCTCCACCTCTAAGCCCAGAC
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerWBGCAS24.forward primerMalus x domesticaprimer
reverse primerWBGCAS24.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
WBGCAS24WBGCAS24Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JGD-F1-2014J12N/A2.3WBGCAS24View