|
Marker Overview
Name | PGS1.23 |
Genbank ID | N/A |
Type | SSR |
Species | Prunus armeniaca |
Repeat Motif | (GA)34 |
Primer 1 | PGS1.23.Forward primer: tttgttatttgttttggttgg |
Primer 2 | PGS1.23.Reverse primer: caggctttttatgtcctcct |
Product Length | 235 |
Publication | [view all] |
Contact | Maria Luisa Badenes V. Decroocq
|
Comment | not broadly applicable for MAS and that marker-assisted breeding based on the sole PPVres locus is not sufficient to unambiguously select PPVresistant apricot cultivars |
Publications
Year | Publication |
2012 | Soriano JM, Domingo ML, Zuriaga E, Romero C, Zhebentyayeva T, Abbott AG, Badenes ML. Identification of simple sequence repeat markers tightly linked to plum pox virus resistancein apricot. Molecular breeding. 2012; 30(2):1017-1026. |
2015 | Sanhueza D, Vizoso P, Balic I, Campos-Vargas R, Meneses C. Transcriptomic analysis of fruit stored under cold conditions using controlled atmosphere in Prunus persica cv. “Red Pearl”. Frontiers in Plant Science. 2015; (6)788. |
|