|
Marker Overview
Name | PGS1.24 |
Genbank ID | N/A |
Type | SSR |
Species | Prunus armeniaca |
Repeat Motif | (GT)22AA(GT)21(GA)24 |
Primer 1 | PGS1.24.Forward primer: gtaaatgagtgcctgcgtgt |
Primer 2 | PGS1.24.Reverse primer: tgcgagagttgtgattgatg |
Product Length | 201 |
Publication | [view all] |
Contact | Maria Luisa Badenes V. Decroocq
|
Comment | not broadly applicable for MAS and that marker-assisted breeding based on the sole PPVres locus is not sufficient to unambiguously select PPVresistant apricot cultivars |
Publications
Year | Publication |
2012 | Soriano JM, Domingo ML, Zuriaga E, Romero C, Zhebentyayeva T, Abbott AG, Badenes ML. Identification of simple sequence repeat markers tightly linked to plum pox virus resistancein apricot. Molecular breeding. 2012; 30(2):1017-1026. |
2016 | Juan Alfonso Salazar, David Ruiz, José Antonio Campoy, Stefano Tartarini, Luca Dondini, Pedro Martínez-Gómez. Inheritance of reproductive phenology traits and related QTL identification in apricot. Tree Genetics & Genomes. 2016; 12(71). |
|