PGS1.252, PGS1.252 (genetic_marker) Prunus armeniaca

Marker Overview
NamePGS1.252
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
Repeat Motif(TC)20
Primer 1PGS1.252.Forward primer: tttctctctctcttacctcaaaa
Primer 2PGS1.252.Reverse primer: cacaagagaaagctcaaagaa
Product Length248
Publication[view all]
ContactMaria Luisa Badenes
Contact
NameDetails
Maria Luisa Badenes
First name:Maria
Last name:Badenes
Title:Professor
Institution:Valencian Institure for Agricultural Research
Address:Apartado Oficial, 46113 Moncada, Valencia, Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerPGS1.252.Forward primerPrunus armeniacaprimer
Reverse primerPGS1.252.Reverse primerPrunus armeniacaprimer


This genetic_marker is adjacent to the following heritable_phenotypic_marker feature(s):

Feature NameUnique NameSpeciesType
resistance to plum pox virusresistance to plum pox virus-PPVresPrunus armeniacaheritable_phenotypic_marker


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PGS1.252PGS1.252Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2012LG1N/A2.5PGS1.252View
2Apricot-integrated-F1-Goldrich-2012LG1N/A4.9PGS1.252View