Gol012, Gol012 (genetic_marker) Prunus armeniaca | GDR

Marker Overview

Marker Overview


Name	Gol012
Genbank ID	N/A
Type	SSR
Species	Prunus armeniaca
PCR Condition	59.99; 57.33
Primer 1	Gol012.Forward Primer: CTTTTCTCGCCCTTTGTGAG
Primer 2	Gol012.Reverse Primer: AAATGGGCTTTGAGTGTATTTC
Product Length	184
Publication	[view all]
Contact	Maria Badenes

Contact

Name

Details

Maria Badenes

First name:	Maria
Last name:	Badenes
Institution:	Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:	Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:	Spain
Email:	badenes_mlu@gva.es

Publications


Year	Publication
2011	Ruiz EMV, Soriano JM, Romero C, Zhebentyayeva T, Terol J, Zuriaga E, Llácer G, Abbott AG, Badenes ML. Narrowing down the apricot Plum pox virus resistance locus and comparative analysis with the peach genome syntenic region. Molecular Plant Pathology. 2011; 12(6):535–547.