Gol051, Gol051 (genetic_marker) Prunus armeniaca

Marker Overview
NameGol051
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
PCR Condition60.55; 57.73
Primer 1Gol051.Forward Primer: TTGGAGTTGTGCAATTGGTG
Primer 2Gol051.Reverse Primer: CACATTCCATTAACATGGTGAC
Product Length165
ContactMaria Badenes
Contact
NameDetails
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol051.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol051.Reverse PrimerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gol051Gol051Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-LL-F2-Lito-2011LG1N/A1.9Gol051View
2Apricot-integrated-Goldrich-2011LG1N/A7.3Gol051View