Gol098, Gol098 (genetic_marker) Prunus armeniaca

Marker Overview
Genbank IDN/A
SpeciesPrunus armeniaca
PCR Condition52.63; 52.38
Primer 1Gol098.Forward Primer: GCTGCCCATGCTGTATTTG
Primer 2Gol098.Reverse Primer: CCCTCTCCTCTTGAGTATTCG
Product Length296
ContactMaria Badenes
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol098.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol098.Reverse PrimerPrunus armeniacaprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gol098Gol098Prunus armeniacamarker_locus

Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer