Gol102, Gol102 (genetic_marker) Prunus armeniaca

Marker Overview
NameGol102
Genbank IDN/A
TypeSSR
SpeciesPrunus armeniaca
PCR Condition59.42; 60.82
Primer 1Gol102.Forward Primer: CACAAGGGGTCCTACACCTC
Primer 2Gol102.Reverse Primer: GGCCCTCCAGGTTCTTTATG
Product Length207
ContactMaria Badenes
Contact
NameDetails
Maria Badenes
First name:Maria 
Last name:Badenes
Institution:Instituto Valenciano de Investigaciones Agrarias (IVIA)
Address:Instituto Valenciano de Investigaciones Agrarias, Apartado Oficial 46113 Moncada, Valencia, Spain
Country:Spain
Email:badenes_mlu@gva.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerGol102.Forward PrimerPrunus armeniacaprimer
Reverse PrimerGol102.Reverse PrimerPrunus armeniacaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Gol102Gol102Prunus armeniacamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apricot-integrated-Goldrich-2011LG1N/A6.9Gol102View