|
Marker Overview
Name | NZ23g4 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (ga)19 |
Primer 1 | NZ23g4.forward primer: tttctctctctttcccaactc |
Primer 2 | NZ23g4.reverse primer: agc cgc ctt gca tta aat ac |
Product Length | 88 |
Publication | [view all] |
Contact | P. Guilford
|
Publications
Year | Publication |
2015 | Luigi Falginella, Guido Cipriani, Corinne Monte, Roberto Gregori, Raffaele Testolin, Riccardo Velasco, Michela Troggio, Stefano Tartarini. A major QTL controlling apple skin
russeting maps on the linkage group 12
of ‘Renetta Grigia di Torriana’. BMC Plant Biology. 2015; 15:150. |
1997 | Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254. |
|