11000-51:G>A, 11000-51:G>A (genetic_marker) Fragaria x ananassa

Marker Overview
Name11000-51:G>A
dbSNP IDN/A
TypeSNP
SNP AllelesG/A
5' Flanking SequenceTGCAGTTCTGATGGATCCTGTTGCTAAAAATTGCTTGAAACATTTTTATT
3' Flanking SequenceGTTACCTTTTACATGGTG
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
11000-51:G>A-LG311000-51:G>A-LG3-67.788Fragaria x ananassamarker_locus
11000-51:G>A11000-51:G>AFragaria x ananassamarker_locus


Sequence
>11000-51:G>A ID=11000-51:G>A|Name=11000-51:G>A|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAGTTCTGATGGATCCTGTTGCTAAAAATTGCTTGAAACATTTTTATT
RGTTACCTTTTACATGGTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-3N/A67.7911000-51:G>A-LG3View
2Strawberry-232x1392-F1-2015LGIII-3N/A72.1311000-51:G>AView