M12715-29:T>C, M12715-29:T>C (genetic_marker) Fragaria x ananassa

Marker Overview
NameM12715-29:T>C
dbSNP IDN/A
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGCAGAGTATCTCCAAGGAATGGGTATT
3' Flanking SequenceTCCCAATACCATACAGTACAAAGTAACCCCCACTGCCCAT
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M12715-29:T>C-LG3M12715-29:T>C-LG3-24.598Fragaria x ananassamarker_locus
M12715-29:T>CM12715-29:T>CFragaria x ananassamarker_locus


Sequence
>M12715-29:T>C ID=M12715-29:T>C|Name=M12715-29:T>C|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAGAGTATCTCCAAGGAATGGGTATTYTCCCAATACCATACAGTACAA
AGTAACCCCCACTGCCCAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-2N/A24.6M12715-29:T>C-LG3View
2Strawberry-232x1392-F1-2015LGIII-2N/A24.71M12715-29:T>CView