M13531-46:A>G, M13531-46:A>G (genetic_marker) Fragaria x ananassa

Marker Overview
NameM13531-46:A>G
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTGCAGGTGTACATAGTGTATTTGGGGCTCAGTCATAACATACATG
3' Flanking SequenceACCTCACCTAACTTCAGAACACC
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M13531-46:A>G-LG3M13531-46:A>G-LG3-96.489Fragaria x ananassamarker_locus
M13531-46:A>GM13531-46:A>GFragaria x ananassamarker_locus


Sequence
>M13531-46:A>G ID=M13531-46:A>G|Name=M13531-46:A>G|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAGGTGTACATAGTGTATTTGGGGCTCAGTCATAACATACATGRACCT
CACCTAACTTCAGAACACC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-2N/A96.49M13531-46:A>G-LG3View
2Strawberry-232x1392-F1-2015LGIII-2N/A99.11M13531-46:A>GView