M14150-21:T>C, M14150-21:T>C (genetic_marker) Fragaria x ananassa

Marker Overview
NameM14150-21:T>C
dbSNP IDN/A
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGCAGAAATTTCAGCGATCC
3' Flanking SequenceTGTTTCAATAGCAGGTTGTTGTTCCCTCGCGGAGGTCCACATGGGGTA
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M14150-21:T>C-LG2M14150-21:T>C-LG2-61.487Fragaria x ananassamarker_locus
M14150-21:T>CM14150-21:T>CFragaria x ananassamarker_locus


Sequence
>M14150-21:T>C ID=M14150-21:T>C|Name=M14150-21:T>C|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAGAAATTTCAGCGATCCYTGTTTCAATAGCAGGTTGTTGTTCCCTCG
CGGAGGTCCACATGGGGTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-3N/A61.49M14150-21:T>C-LG2View
2Strawberry-232x1392-F1-2015LGIII-3N/A70.12M14150-21:T>CView