M15630-5:C>A, M15630-5:C>A (genetic_marker) Fragaria x ananassa

Marker Overview
NameM15630-5:C>A
dbSNP IDN/A
TypeSNP
SNP AllelesC/A
5' Flanking SequenceTGCA
3' Flanking SequenceCATTTGTTTTTTCTCTTTTATCAGAGAATGTATGTGGTATTTCATTTGTTGAACTTGGAT TTGC
SpeciesFragaria x ananassa
Publication[view all]
ContactIraida Amaya
Contact
NameDetails
Iraida Amaya
First name:Iraida
Last name:Amaya
Title:Researcher
Institution:IFAPA-Centro de Churriana
Address:Cortijo de la Cruz S/N, Churriana, 29140 Ma´laga, Spain
Country:Florida
Email:iraida.amaya@juntadeandalucia.es
Phone:+34 951 036218
Keywords:Strawberry
Last update:2014
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
M15630-5:C>A-LG1M15630-5:C>A-LG1-56.618Fragaria x ananassamarker_locus
M15630-5:C>AM15630-5:C>AFragaria x ananassamarker_locus


Sequence
>M15630-5:C>A ID=M15630-5:C>A|Name=M15630-5:C>A|organism=Fragaria x ananassa|type=genetic_marker|length=69bp
TGCAMCATTTGTTTTTTCTCTTTTATCAGAGAATGTATGTGGTATTTCAT
TTGTTGAACTTGGATTTGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Strawberry-232x1392-F1-2014LGIII-2N/A56.62M15630-5:C>A-LG1View
2Strawberry-232x1392-F1-2015LGIII-2N/A59M15630-5:C>AView