|
|
Marker Overview
| Name | ZFRIt047 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pyrus spp. |
|---|
| PCR Condition | 58 |
|---|
| Primer 1 | ZFRIt047.forward primer: GGTGCTGTAAGGTGGTGATG |
|---|
| Primer 2 | ZFRIt047.reverse primer: ATGAAACCAGCCAAACAACC |
|---|
| Publication | [view all] |
|---|
| Contact | Lei Wang
|
|---|
Publications
| Year | Publication |
|---|
| 2016 | Wang, L., Wang, L., Xue, H.B., Li, X.G., Li, J. Construction of SSR genetic linkage map and comparison on pears. Sci. Agric. Sinica. 2016. 49 (12), 2353–2367 |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| forward primer | ZFRIt047.forward primer | Pyrus spp. | primer |
| reverse primer | ZFRIt047.reverse primer | Pyrus spp. | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
| Feature Name | Unique Name | Species | Type |
|---|
| ZFRIt047 | ZFRIt047-21.952 | Pyrus spp. | marker_locus |
| ZFRIt047 | ZFRIt047-17.843 | Pyrus spp. | marker_locus |
| ZFRIt047 | ZFRIt047-20.522 | Pyrus spp. | marker_locus |
|
