ZFRIt066, ZFRIt066 (genetic_marker) Pyrus spp. | GDR

Marker Overview

Marker Overview


Name	ZFRIt066
Genbank ID	N/A
Type	SSR
Species	Pyrus spp.
PCR Condition	55
Primer 1	ZFRIt066.forward primer: TGGCTTTAAACGGTTATGCTG
Primer 2	ZFRIt066.reverse primer: TGAGGAGGGAGGGAATACAA
Publication	[view all]
Contact	Lei Wang

Contact

Name

Details

Lei Wang

First name:	Lei
Last name:	Wang
Institution:	Xinjiang Agricultural University
Address:	College of Horticulture & Forestry Sciences, Xinjiang Agricultural University, Urumqi 830052
Country:	China
Email:	ewlei@163.com
Phone:	13653825516

Publications


Year	Publication
2016	Wang, L., Wang, L., Xue, H.B., Li, X.G., Li, J. Construction of SSR genetic linkage map and comparison on pears. Sci. Agric. Sinica. 2016. 49 (12), 2353–2367

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-Rcf-F1-female	LG1	N/A	149.25	ZFRIt066	View
2	Pear-M-F1-male	LG1	N/A	100.76	ZFRIt066	View
3	Pear-RM-F1-Integrated	LG1	N/A	127.59	ZFRIt066	View